GC content, base counts and melting temperature

How this is calculated

GC content is (G + C) ÷ (A + C + G + T) as a percentage. Only unambiguous bases go into that fraction: IUPAC codes such as N or R, and anything else in the box, are counted separately under other and left out of the GC figure, because an N could be either. U is counted as T.

The melting temperature uses the SantaLucia 1998 unified nearest-neighbour parameters, the same code the PlasmidLab app uses for primers. It adds up the enthalpy and entropy of each of the overlapping two-base steps along the oligo, plus a correction for each end, applies the salt correction of 0.368 × (N − 1) × ln[Na⁺] to the entropy, and solves Tm = ΔH ÷ (ΔS + R·ln[oligo]) − 273.15.

Two assumptions are built into that number, and both are editable above: the sodium concentration, 50 mM by default, and the oligo concentration, 250 nM by default, taken as a primer in excess over its template as in a PCR; for two strands annealed at equal concentration C, enter C/2. The model also assumes a perfectly matched duplex of the oligo and its exact complement, in a two-state transition with no hairpins, no dangling ends and no magnesium or dNTP term. For a 20-mer such as GCGTAACGATCCAGCTGTCG those defaults give 59.9 °C.

Above 50 bases there is no melting temperature here, and that is not a limit of the page. The nearest-neighbour model describes a short duplex that melts all at once; a long sequence melts domain by domain, so a single Tm is not the right description of it. For long DNA the counts and GC content are shown and nothing else.

Everything runs in your browser. The sequence is not sent anywhere.